pRNA-H1.1/Retro

You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Retro

Description

pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives siRNA expression. the siRNA insert cloned between the Mlu and Xho sites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR). It uses MSV 3'LTR for viral transcription and packaging.

Storage

Store at -20°C

Download Protocol

TM0187

Forward Sequencing Primer

DA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)

Reverse Sequencing Primer

DA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Detailed Map

5' LTR: 1 - 727
3' LTR: 4768 - 5063
psi+: 757 - 1566
ColE1 ori: 6650 - 5764
SV40 ori & promoter: 5320 - 5664
Polylinker: 4596 - 4619
H1 Promoter: 4719 - 4620
CMV Promoter: 1604 - 2132
Hygromycin: 2901 - 3921
Ampicillin: 7570 - 6710

Vector Sequence and Restriction Enzyme Map

Document

Document-PRODUCTINFO: 1153_20051024014300.PDF (PDF)

TECHNICAL MANUAL: 402_20050708115745.PDF (PDF)


1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.