![]() *This product has been discontinued! *
pRNA-H1.1/RetroDescriptionpRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives siRNA expression. the siRNA insert cloned between the Mlu and Xho sites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR). It uses MSV 3'LTR for viral transcription and packaging.![]() ![]() StorageStore at -20°CDownload ProtocolTM0187Forward Sequencing PrimerDA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)Reverse Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Detailed Map5' LTR: 1 - 7273' LTR: 4768 - 5063 psi+: 757 - 1566 ColE1 ori: 6650 - 5764 SV40 ori & promoter: 5320 - 5664 Polylinker: 4596 - 4619 H1 Promoter: 4719 - 4620 CMV Promoter: 1604 - 2132 Hygromycin: 2901 - 3921 Ampicillin: 7570 - 6710 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||





