![]() pRNAT-H1.4/RetroDescriptionpRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5’LTR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging.![]() StorageStore at -20°CDownload ProtocolTM0187Forward Sequencing PrimerDA0025: SD1241 Forward (TGTAGGTTTGGCAAGCTAGC)Reverse Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Detailed Map5' LTR: 1 - 7273' LTR: 5460 - 5755 psi+: 757 - 1566 ColE1 ori: 6456 - 7342 SV40 ori & promoter: 6012 - 6356 IRES: 2975 - 3555 Polylinker: 5288 - 5311 H1 Promoter: 5312 - 5411 CMV Promoter: 1604 - 2132 cGFP: 2247 - 2966 Hygromycin: 3593 - 4613 Ampicillin: 7402 - 8262 Vector Sequence and Restriction Enzyme Map Document
Related Products
|
||||||||||












