You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector: pRNAT-CMV3.2/Hygro
|
||||||||||
![]() pRNAT-CMV3.2/HygroDescriptionThe Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a great variety of mammalian cell lines, than RNA-polymerase III-based promoters such as U6 and H1. In this vector, a CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites.![]() StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 584 - 651CMV Promoter: 1 - 583 cGFP: 1598 - 2317 SV40 Promoter: 1267 - 1598 Hygromycin: 2911 - 3936 pUC ori: 4636 - 5276 Ampicillin: 5424 - 6284 Vector Sequence and Restriction Enzyme Map Document
Related Products
|
||||||||||












