You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Hygro/siLuc
|
||||||||||
![]() pRNA-H1.1/Hygro/siFLucDescriptionpRNA-H1.1/Hygro/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4819 - 4888H1 Promoter: 4719 - 4818 SV40 Promoter: 597 - 942 Hygromycin: 965 - 1990 pUC ori: 2660 - 3300 Ampicillin: 3448 - 4308 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||












