![]() *This product has been discontinued! *
pRNAT-U6.1/Hygro/siFLucDescriptionpRNAT-U6.1/Hygro/siFluc is a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP), which is under CMV promoter control, can be used to track the transfection efficiency. It uses a U6 promoter for siRNA expression. This vector contains an siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 147U6 Promoter: 6354 - 77 CMV Promoter: 186 - 782 cGFP: 798 - 1517 SV40 Promoter: 2206 - 2551 Hygromycin: 2574 - 3599 pUC ori: 4269 - 4909 Ampicillin: 5057 - 5917 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||




