You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNATin-H1.2/Neo/siFLuc
|
||||||||||
![]() pRNATin-H1.2/Neo/siFLucDescriptionpRNATin-H1.2/Neo/siFluc is a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) , which is under CMV promoter control, can be used to track the transfection efficiency. It uses the H1.2 promoter, an engineered inducible promoter containing a tetracycline operator (TetO1), for siRNA expression. This vector contains an siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion.
StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 6168 - 64H1 Promoter: 6068 - 6167 CMV Promoter: 103 - 691 cGFP: 707 - 1426 SV40 Promoter: 2115 - 2460 Neomycin: 2501 - 3295 pUC ori: 4009 - 4649 Ampicillin: 4797 - 5657 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||












