You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-CMV3.1/Neo/siFLuc
|
||||||||||
![]() pRNA-CMV3.1/Neo/siFLucDescriptionpRNA-CMV3.1/Neo/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses a CMV promoter for siRNA expression. This vector contains a siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 584 - 653CMV Promoter: 1 - 583 SV40 Promoter: 1269 - 1614 Neomycin: 1655 - 2449 pUC ori: 3163 - 3803 Ampicillin: 3951 - 4811 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||












