You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-U6.3/Neo/siFluc
|
||||||||||
![]() pRNA-U6.3/Neo/siFLucDescriptionpRNA-U6.3/Neo/siFLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses U6 promoter for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() ![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapCMV IE: 4807 - 5290siFluc: 84 - 141 Polylinker: 78 - 147 U6 Promoter: 5298 - 77 SV40 Promoter: 896 - 1241 Neomycin: 1282 - 2076 pUC ori: 2790 - 3430 Ampicillin: 3578 - 4438 Vector Sequence and Restriction Enzyme Map
|
||||||||||













