molecular biology services
Cat. No.
Name
Size   
Price
Selected
SD1552
10 μg
$225

pRNA-H1.3/Neo

Description
pRNA-H1.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.




Storage
Store at -20°C


Download Protocol
tm0169


Forward Sequencing Primer
DA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)

Reverse Sequencing Primer
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map

CMV IE: 4559 - 5042
siFluc: 5148 - 5205
Polylinker: 5142 - 5211
H1 Promoter: 5049 - 5143
SV40 Promoter: 647 - 992
Neomycin: 1033 - 1827
pUC ori: 2541 - 3181
Ampicillin: 3329 - 4189

Vector Sequence and Restriction Enzyme Map



Document

  • Document-DATASHEET: SD1552_datasheet.pdf (pdf)

  • 1
    Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.23/bp, with advanced FREE codon optimization tool and seamless cloning technology.
    2
    PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
    3
    Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
    4
    Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.