
pRNA-H1.3/NeoDescriptionpRNA-H1.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.


StorageStore at -20°C
Download Protocoltm0169
Forward Sequencing Primer
DA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)
Reverse Sequencing Primer
DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map
CMV IE: 4559 - 5042
siFluc: 5148 - 5205
Polylinker: 5142 - 5211
H1 Promoter: 5049 - 5143
SV40 Promoter: 647 - 992
Neomycin: 1033 - 1827
pUC ori: 2541 - 3181
Ampicillin: 3329 - 4189
Vector Sequence and Restriction Enzyme Map
Document
Document-PRODUCTINFO: 1189_20051024025951.PDF (PDF)
 |
1 |
Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology. |
2 |
PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days. |
3 |
Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package. |
4 |
Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50. |
|