Email to GenScript

pRNA-H1.3/Neo


*This product has been discontinued! *

Description

pRNA-H1.3/Neo

Description
pRNA-H1.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.


Storage Store at -20°C
Forward Sequencing Primer DA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)
Reverse Sequencing Primer DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map CMV IE: 4559 - 5042
siFluc: 5148 - 5205
Polylinker: 5142 - 5211
H1 Promoter: 5049 - 5143
SV40 Promoter: 647 - 992
Neomycin: 1033 - 1827
pUC ori: 2541 - 3181
Ampicillin: 3329 - 4189

Vector Sequence and Restriction Enzyme Map





Notice there is no results found, you can visit "Citations Database" for other results.

FAQs

COAs

SDS

For more documents, please visit "Technical Support".