pRNAT-H1.3/Hygro/siFLuc

You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA positive control : pRNAT-H1.3/Hygro/siFluc

pRNAT-H1.3/Hygro/siFLuc

Description

a GenScript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. This vector contains the siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.

Storage

Store at -20°C

Download Protocol

tm0169

Forward Sequencing Primer

DA0032: SD1563 Forward (CTGGGAAATCACCATAAACG)

Reverse Sequencing Primer

DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Detailed Map

CMV IE: 7 - 490
siFluc: 596 - 653
Polylinker: 590 - 659
H1 Promoter: 497 - 591
CMV Promoter: 698 - 1285
cGFP: 1302 - 2021
SV40 Promoter: 2710 - 3055
Hygromycin: 3078 - 4103
pUC ori: 4773 - 5413
Ampicillin: 5561 - 6421

Vector Sequence and Restriction Enzyme Map

Document

Document-PRODUCTINFO: 1296_20051215031925.PDF (PDF)


1	Gene Synthesis: GenScript's custom gene synthesis service starts as LOW as $0.39/bp, with advanced FREE codon optimization tool and seamless cloning technology.
2	PCR Cloning and Subcloning: Start GenScript's flexible PCR cloning and subcloning service RIGHT NOW, getting comprehensive packages delivered in 14 business days.
3	Site-directed Mutagenesis Services: $149/mutation for special mutagenesis bundle. Site-directed Mutagenesis offers point mutations, deletions, and insertions with unparalleled accuracy, unlimited sites, and comprehensive service package.
4	Plasmid DNA Preparation: GenScript plasmid DNA preparation services offer endotoxin FREE and predominantly supercoiling plasmid DNA from 100 ug to 1000 mg start from $50.