You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Neo/siRLuc
|
||||||||||
![]() pRNA-H1.1/Neo/siRLucDescriptionpRNA-H1.1/Neo/siRLuc is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4700 - 4769H1 Promoter: 4600 - 4699 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||












