You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-H1.1/Neo/sicGFP
|
||||||||||
![]() pRNA-H1.1/Neo/sicGFPDescriptionpRNA-H1.1/Neo/sicGFP is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an H1 promoter for siRNA expression. This vector contains an siRNA construct for cGFP (coral green fluorescence protein) and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4703 - 4777H1 Promoter: 4600 - 4699 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189 Vector Sequence and Restriction Enzyme Map Document
Related Products
|
||||||||||












