|
||||||||||
 *This product has been discontinued! *
pRNA-H1.1/Neo/CTLDescriptionpRNA-H1.1/Neo/CTL is a GenScript general-purpose siRNA negative control vector. It is designed for mammalian transfection. It uses an H1 promoter for siRNA expression. The sense sequence shows no homology to any mouse or rat mRNA sequence in the NCBI RefSeq database. It can be used as a negative control and as a siRNA vector. This vector employs BamH I and Hind III for siRNA insertion. StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 4700 - 4767H1 Promoter: 4600 - 4699 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||
- Home
- Services
- Products
- Nucleic Acid Purification & Analysis
- PCR and Cloning
- Recombinant Proteins
- Proteins, Expression, Isolation and Analysis
- Antibodies
- Peptides & Biochemicals
- Cellular Analysis
- New Products
- Resources
- Promotions
- Special Promotions
- Service Promotions
- Peptide Promotion: Peptide Standard Synthesis 25% OFF till (07/31/2013).
- Friday Promotion: Gene Synthesis 20% off, $0.28/bp till (07/31/2013).
- PolyExpress™ Guaranteed Antibody Package: Get your pAb in 45 Days, starting from $499.
- MonoExpress™ Western Guaranteed Antibody Package: Get your mAb in 45 Days, starting from $3,800 (till 03/31/2013).
- BacPower™ Guaranteed Package: 3 mg purified protein starting from $2,200 till (06/30/2013).
- Guaranteed Antibody Package: 50 mg purified antibody starting from only $8,499 till (06/30/2013).
- Product Promotions
- Company
© 2002-2013 GenScript USA Inc. All rights reserved.