Overview

GenScript provides the synthesis service for RT-qPCR primers and probes of the sequences recommended by WHO and CDC.

Gene Name Oligo Name oligo Sequence(5'-3') Length (nt)
RdRP gene RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG 22
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA 26
RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 25
RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 26
E gene E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT 26
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA 22
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 26
N gene N gene-F GGGGAACTTCTCCTGCTAGAAT 22
N gene-R CAGACATTTTGCTCTCAAGCTG 22
N gene-P TTGCTGCTGCTTGACAGATT 20
ORF1ab gene ORF1ab-F CCCTGTGGGTTTTACACTTAA 21
ORF1ab-R ACGATTGTGCATCAGCTGA 19
ORF1ab-P CCGTCTGCGGTATGTGGAAAGGTTATGG 28

We have two different standards to fulfill your request:

  • Research use only
  • Clinical used (ISO13485 certified synthesis)

GenScript also offers any other customized primers and probes for COVID-19 research. Please contact our technical support managers for more information via email [email protected]. Our technical account managers will contact you in 24 hours.

Download Technical Note!
Download Technical Note!

What you need to know about SARS-CoV-2 qRT-PCR detection assay

GenScript Press Release about COVID-19

Forbes article on Synthetic Bio Companies Racing to Fight Coronavirus here 

Reuters article: Countries rush to build diagnostic capacity as coronavirus spreads

Genetic Engineering & Biotechnology News: Detecting Coronavirus Cases as Outbreak Grows here

GenScript is mentioned in a Coronavirus story mostly about Novacyt that was written by Reuters, but picked up by The New York Times here today

Medical Device & Diagnostics Online article here

LabPulse article here

GenomeWeb article here

Biospace Blog: China Coronavirus Update: Continued Spread, Run on Antivirals and Facemasks, Baby Diagnosed

To place order or need technical support for coronavirus detection assay, please contact:

Plasmids Used for SARS-CoV-2 Detection and Research are In Stock Now!

The plasmids containing parts of SARS-CoV-2 RdRP gene, N gene, E gene that can be used as positive controls for SARS-CoV-2 detection are in stock now. A group of plasmids carrying the encoding sequences of surface glycoprotein and nucleocapsid phosphoprotein are also available. The quick online order channel has been launched on MolecularCloud.

REQUEST A QUOTE