Mutagenesis (* Required fields) send
* Construct name:
* Choose library type:
Site-directed mutagenesis libraries     Help
Sequential permutation scanning libraries     Help
Randomized and degenerated libraries     Help
       Combinatorial Assembly Libraries      Help
       Truncation Variant Libraries      Help
* Can you provide the template?
Yes
No
Template sequence and mutation:
Please submit the sequence from the area of interest and use different character case for degenerated sties.
Example:
Name of the template
GAATTCTTAATTATATTAAATCAAAATAAAAATTTAAAATCACTCGATATACAATCTTGT
XTGAATAGCTCTTGAAAGCTAGCAATCAGGAACTTATATATTGAGTGATTTTTTGATTC
C TTATCAATTGTAAATTATAGTAGAGAAGTCCATTTTGGAGATTATAAAGTTATTTTTAT
GTGTCTTTGACCAAAATAGTAACATCTCTTTCCXGGGTTGTGGCATGGCACTGTGGA
TCGGCAAACAGATTTCTGGCCCGCAAGGGCTGTTTTATGCGGACAAAGAATCTCTG
GAAGCGAA AGGTGCAAAAATCTATATGGAATCACCTGTCACTGCAATTGATTATXAC
GCGAAACGTGT AACAGCTCTGGTGAACGGACAGGAGCATGTGGAAAGTTATGAGA
AACTGATTCTGGCTAC
*Sequence of interest below:

Position and type of degenerated sites (if not specified in sequence field):

Other requirements, questions, or comments:
Target vector same as template
PCR products
Other

5. Plasmid Prep
Standard delivery: 4 μg (Free of charge)
Custom plasmid preparation (additional charge)

Requirements for your quote:
Requirements: