CORIN CRISPR guide RNA, corin, serine peptidase CRISPR guide RNA[human]

gRNA/crRNA for genome editing with WT SpCas9 vector or cas9 protein

The following gRNA sequences were designed by Feng Zhang’s laboratory at the Broad institute* to uniquely target the CORIN gene within the human genome. These gRNA sequences are for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. These sgRNA sequences were validated in Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4.

gRNA or crRNA (name)	gRNA target sequence	Format	Availability*	Price	Select
CORIN CRISPR Guide RNA or crRNA 1	TCGCCATCAATGATGCACTC	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00
CORIN CRISPR Guide RNA or crRNA 2	CCTCCTCCGGTTCCTATTGC	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00
CORIN CRISPR Guide RNA or crRNA 3	AGGTGTCAGCGTGGCGTGGT	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00
CORIN CRISPR Guide RNA or crRNA 4	ACCCACCAACATAGGAAAGC	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00
CORIN CRISPR Guide RNA or crRNA 5	AATTTGCTTCTCACCTCAGC	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00
CORIN CRISPR Guide RNA or crRNA 6	AGGAGTAATTCACCATCCCC	Plasmid vector	On-demand	$199.00
		sgRNA	On-demand	From $99.00

*GenScript provides in-stock gRNA clones for select genes; however, they must still undergo amplification and QC processing. These clones will be delivered within 6 business days.

Add To Cart

Description of CORIN CRISPR guide RNA

Search for other guide RNAs

The CORIN CRISPR guide RNA sequences shown above were designed by the laboratory of Feng Zhang at the Broad Institute* in order to efficiently target the CORIN gene with minimal risk of off-target Cas9 binding elsewhere in the genome. For complete details on the criteria and process for guide RNA design and selection, please see: Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Read the Full Text

Based on our experience using our design tool to create knock-out cell lines, a single gRNA construct is typically sufficient to knock-out your gene of interest, but to increase your chance of success, we recommend ordering at least two gRNA constructs per gene that you want to target. We recommend that you double-check the gRNA sequences against your target gene sequence of interest before ordering, especially if you are trying to target only one specific splice variant or a specific exon.

When you order gRNA clones from GenScript, we deliver a sequence-verified plasmid containing all elements required for gRNA expression and genome binding: the U6 promoter, spacer (target) sequence, gRNA scaffold, and terminator. You may select from vectors that include selection markers. We guarantee sequence accuracy for gRNA clones we deliver; however, given the complexity of creating genomically edited cell lines, we cannot guarantee the outcome of experiments using our gRNA constructs. If you prefer to receive sequence-validated KO or KI cell lines created using CRISPR technology, please refer to our GenCRISPR™ mammalian cell line service.

Price & Turnaround time of CORIN CRISPR guide RNA

• $199.00/clone includes:
  • gRNA design services: Select from gRNAs above, which were designed by the Feng Zhang lab at the Broad Institute to target human and mouse genes with high specificity. Alternatively, our expert scientists will design guide RNA sequences according to your needs, for any species or genome editing strategy, when you use our online request form. We strongly recommend ordering at least 2 or more gRNAs for each target sequence.
  • gRNA synthesis and cloning into any vector of your choice, including free all-in-one vectors. The cost for gRNA constructs is $199.00/clone no matter which vector you select. Genscript offers several options for lentiviral or nonviral delivery, all suitable for use in any mammalian system. See our gRNA vector guide for details. If you prefer a different vector, simply mail an aliquot to us and we will perform subcloning at no additional cost.
• GenCRISPR™ gRNA constructs are custom-synthesized and cloned into your choice of vector within 10 business days.
• Our Ph.D.–level gene service representatives can answer any questions you have and help tailor our services to your needs. When you request a quote, we will contact you within 24 hours.