For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Antibacterial Fusobacterium nucleatum-Mimicking Nanomedicine to Selectively Eliminate Tumor-Colonized Bacteria and Enhance Immunotherapy Against Colorectal Cancer

Adv Mater .. 2023-09; 
Linfu Chen , Rui Zhao , Jingjing Shen , Nanhui Liu , Zixuan Zheng , Yu Miao , Jiafei Zhu , Lin Zhang , Yingyao Wang , Huapan Fang , Jun Zhou , Maoyi Li , Yang Yang , Zhuang Liu , Qian Chen
Products/Services Used Details Operation
Gene Synthesis . The primer and probe sequences for each assay were as follows: F. nucleatum genes forward primer, CAACCATTACTTTAACTCTACCATGTTCA; F. nucleatum genus reverse primer, ATTGACTTTACTGAGGGAGATTATGTAAAAATC; mouse GAPDH forward primer, GGTTGTCTCCTGCGACTTCA; mouse GAPDH reverse primer, TGGTCCAGGGTTTCTTACTCC.The primes were synthesized by Genscript. Get A Quote

Abstract

Clinical evidence indicates that tumor-colonizing bacteria can be closely related to the tumor development and therapeutic responses. Selectively eliminating bacteria within tumors may be an attractive approach to enhance cancer treatment without additional side effects. Herein, it is found that, owing to the high affinity between the membrane protein Fap-2 on Fusobacterium nucleatum and d-galactose-β (1-3)-N-acetyl-d-galactosamine (Gal-GalNAc) overexpressed on colorectal tumor cells, F. nucleatum can colonize in colorectal tumors, as evidenced by both clinical samples and animal tumor models. Notably, F. nucleatum colonized in colorectal tumors can lead to an immunosuppressive tumor microenvironment, greatly ... More

Keywords

Fusobacterium nucleatum; biomimetic nanomedicine; colorectal cancer; immunoresistence; targeted drug delivery.