For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Opsin 5 mediates violet light-induced early growth response-1 expression in the mouse retina

Sci Rep. 2023-10; 
Heonuk Jeong, Deokho Lee, Xiaoyan Jiang, Kazuno Negishi, Kazuo Tsubota, Toshihide Kurihara
Products/Services Used Details Operation
Gene Synthesis … Egr-1 mRNA expression in the … plasmid containing the mouse Opn5 gRNA sequence (GCTCAGGTGCATAGTCCCCC) and a puromycin resistance gene was synthesized by GenScript (… Get A Quote

Abstract

Myopia is an abnormal vision condition characterized by difficulties in seeing distant objects. Myopia has become a public health issue not only in Asian countries but also in Western countries. Previously, we found that violet light (VL, 360-400 nm wavelength) exposure effectively suppressed myopia progression in experimental chick and mice models of myopia. The inhibitory effects of VL on myopia progression are reduced in retina-specific opsin 5 (Opn5) knockout (KO) mice. Furthermore, VL exposure upregulated early growth response-1 (Egr-1) expression in the chorioretinal tissues of chicks. However, the expression of EGR-1 and role of OPN5 in mice following VL exposure remain unclear. In this study, we examin... More

Keywords