• English
  • Sign In
  • Contact Us
×
Catalog Products » Other Products » pRNAT-H1.1/Adeno

pRNAT-H1.1/Adeno

*This product has been discontinued!*
Description

pRNAT-H1.1/Adeno

Description
GenScript pRNAT-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An H1 promoter is used to drive siRNA expression. The vector contains a cGFP marker under the control of cytomegalovirus (CMV) promoter*, which can be used to track transfection efficiency. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication.

Polylinker Start 2112
Polylinker End 2141
u6 Start 0
U6 End 0
H1 Start 2012
H1 End 2111
Cmv Start 1944
Cmv End 1356
Cgfp End 622
Cgfp Start 1333
Sv40 Ori Promoter Start 0
Sv40 Start 0
Zeo End 0
Zeo Start 0
Hygro End 0
Hygro Start 0
Neo End 0
Neo Start 0
Puc Ori End 0
Puc Ori Start 0
Amp End 0
Amp Start 0
T7 End 0
T7 Start 0
P10 End 0
P10 Start 0
F1 End 0
F1 Start 0
T7 Term End 0
T7 Term Start 0
Orf603 End 0
Orf603 Start 0
Orf1629 End 0
Orf1629 Start 0
Ltr End 3 0
Ltr End 5 0
Ltr Start 3 0
Ltr Start 5 0
Psi End 0
Psi Start 0
Puromycin End 0
Puromycin Start 0
Gentamicin End 0
Gentamicin Start 0
Cmv Ie End 0
Cmv Ie Start 0
Pbr322 Origin End 6269
Pbr322 Origin Start 5602
Kanamycin End 7850
Kanamycin Start 7059
Sifluc End 0
Sifluc Start 0
Cole1 Ori End 0
Cole1 Ori Start 0
Sv40 End 0
Sv40 Ori Promoter End 0
Ires End 0
Ires Start 0
Mcs End1 0
Mcs Start1 0
Forward Sequencing Primer DA0013
Reverse Sequencing Primer DA0014
Sequence
nnnttaattaannntcccttccagctctctgccccttttggattgaagccaatatgataa
tgagggggtggagtttgtgacgtggcgcggggcgtgggaacggggcgggtgacgtagtag
tgtggcggaagtgtgatgttgcaagtgtggcggaacacatgtaagcgacggatgtggcaa
aagtgacgtttttggtgtgcgccggtgtacacaggaagtgacaattttcgcgcggtttta
ggcggatgttgtagtaaatttgggcgtaaccgagtaagatttggccattttcgcgggaaa
actgaataagaggaagtgaaatctgaataattttgtgttactcatagcgcgtaannncgc
gttaagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctt
tatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaaca
agttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggt
tttttaaagcaagtaaaacctctacaaatgtggtatggctgattatgatcagttatctag
atccggtggatctgagtccggacttgtacagctcgtccatgccgagagtgatcccggcgg
cggtcacgaactccagcaggaccatgtgatcgcgcttctcgttggggtctttgctcaggg
cggactgggtgctcaggtagtggttgtcgggcagcagcacggggccgtcgccgatggggg
tgttctgctggtagtggtcggcgagctgcacgctgccgtcctcgatgttgtggcggatct
tgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgttgtggctgt
tgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgccct
tcagctcgatgcggttcaccagggtgtcgccctcgaacttcacctcggcgcgggtcttgt
agttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcgg
acttgaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagcactgcacgccgt
aggtcagggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatga
acttcagggtcagcttgccgtaggtggcatcgccctcgccctcgccggacacgctgaact
tgtggccgtttacgtcgccgtccagctcgaccaggatgggcaccaccccggtgaacagct
cctcgcccttgctcaccatggtggcgaccggtagcgctagcggatctgacggttcactaa
accagctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatgg
ggcggagttgttacgacattttggaaagtcccgttgattttggtgccaaaacaaactccc
attgacgtcaatggggtggagacttggaaatccccgtgagtcaaaccgctatccacgccc
attgatgtactgccaaaaccgcatcaccatggtaatagcgatgactaatacgtagatgta
ctgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccattt
accgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaa
gtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgt
tactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagcc
aggcgggccatttaccgtaagttatgtaacgcggaactccatatatgggctatgaactaa
tgaccccgtaattgattactattannnctagcagatctggtaccgtcgacttaatacgac
tcactatagggagagagagagaattaccctcactaaagatatttgcatgtcgctatgtgt
tctgggaaatcaccataaacgtgaaatgtctttggatttgggaatcttataagttctgta
tgagaccactcacgcgtgagctcggtaccctcgagaagctttctagagGATCTGGGCGTG
GTtaagggtgggaaagaatatataaggtgggggtcttatgtagttttgtatctgttttgc
agcagccgccgccgccatgagcaccaactcgtttgatggaagcattgtgagctcatattt
gacaacgcgcatgcccccatgggccggggtgcgtcagaatgtgatgggctccagcattga
tggtcgccccgtcctgcccgcaaactctactaccttgacctacgagaccgtgtctggaac
gccgttggagactgcagcctccgccgccgcttcagccgctgcagccaccgcccgcgggat
tgtgactgactttgctttcctgagcccgcttgcaagcagtgcagcttcccgttcatccgc
ccgcgatgacaagttgacggctcttttggcacaattggattctttgacccgggaacttaa
tgtcgtttctcagcagctgttggatctgcgccagcaggtttctgccctgaaggcttcctc
ccctcccaatgcggtttaaaacataaataaaaaaccagactctgtttggatttggatcaa
gcaagtgtcttgctgtctttatttaggggttttgcgcgcgcggtaggcccgggaccagcg
gtctcggtcgttgagggtcctgtgtattttttccaggacgtggtaaaggtgactctggat
gttcagatacatgggcataagcccgtctctggggtggaggtagcaccactgcagagcttc
atgctgcggggtggtgttgtagatgatccagtcgtagcaggagcgctgggcgtggtgcct
aaaaatgtctttcagtagcaagctgattgccaggggcaggcccttggtgtaagtgtttac
aaagcggttaagctgggatgggtgcatacgtggggatatgagatgcatcttggactgtat
ttttaggttggctatgttcccagccatatccctccggggattcatgttgtgcagaaccac
cagcacagtgtatccggtgcacttgggaaatttgtcatgtagcttagaaggaaatgcgtg
gaagaacttggagacgcccttgtgacctccaagattttccatgcattcgtccataatgat
ggcaatgggcccacgggcggcggcctgggcgaagatatttctgggatcactaacgtcata
gttgtgttccaggatgagatcgtcataggccatttttacaaagcgcgggcggagggtgcc
agactgcggtataatggttccatccggcccaggggcgtagttaccctcacagatttgcat
ttcccacgctttgagttcagatggggggatcatgtctacctgcggggcgatgaagaaaac
ggtttccggggtaggggagatcagctgggaagaaagcaggttcctgagcagctgcgactt
accgcagccggtgggcccgtaaatcacacctattaccgggtgcaactggtagttaagaga
gctgcagctgccgtcatccctgagcaggggggccacttcgttaagcatgtccctgactcg
catgttttccctgaccaaatccgccagaaggcgctcgccgcccagcgatagcagttcttg
caaggaagcaaagtttttcaacggtttgagaccgtccgccgtaggcatgcttttgagcgt
ttgaccaagcagttccaggcggtcccacagctcggtcacctgctctacggcatctcgatc
cagcatatctcctcgtttcgcgggttggggcggctttcgctgtacggcagtagtcggtgc
tcgtccagacgggccagggtcatgtctttccacgggcgcagggtcctcgtcagcgtagtc
tgggtcacggtgaaggggtgcgctccgggctgcgcgctggccagggtgcgcttgaggctg
gtcctgctggtgctgaagcgctgccggtcttcgccctgcgcgtcggccaggtagcatttg
accatggtgtcatagtccagcccctccgcggcgtggcccttggcgcgcagcttgcccttg
gaggaggcgccgcacgaggggcagtgcagacttttgagggcgtagagcttgggcgcgaga
aataccgattccggggagtaggcatccgcgccgcaggccccgcagacggtctcgcattcc
acgagccaggtgagctctggccgttcggggtcaaaaaccaggtttcccccatgctttttg
atgcgtttcttacctctggtttccatgagccggtgtccacgctcggtgacgaaaaggctg
tccgtgtccccgtatacagactnnngtttaaacgaattcnnntataaaatgcaaggtgct
gctcaaaaaatcaggcaaagcctcgcgcaaaaaagaaagcacatcgtagtcatgctcatg
cagataaaggcaggtaagctccggaaccaccacagaaaaagacaccatttttctctcaaa
catgtctgcgggtttctgcataaacacaaaataaaataacaaaaaaacatttaaacatta
gaagcctgtcttacaacaggaaaaacaacccttataagcataagacggactacggccatg
ccggcgtgaccgtaaaaaaactggtcaccgtgattaaaaagcaccaccgacagctcctcg
gtcatgtccggagtcataatgtaagactcggtaaacacatcaggttgattcatcggtcag
tgctaaaaagcgaccgaaatagcccgggggaatacatacccgcaggcgtagagacaacat
tacagcccccataggaggtataacaaaattaataggagagaaaaacacataaacacctga
aaaaccctcctgcctaggcaaaatagcaccctcccgctccagaacaacatacagcgcttc
acagcggcagcctaacagtcagccttaccagtaaaaaagaaaacctattaaaaaaacacc
actcgacacggcaccagctcaatcagtcacagtgtaaaaaagggccaagtgcagagcgag
tatatataggactaaaaaatgacgtaacggttaaagtccacaaaaaacacccagaaaacc
gcacgcgaacctacgcccagaaacgaaagccaaaaaacccacaacttcctcaaatcgtca
cttccgttttcccacgttacgtaacttcccattttaagaaaactacaattcccaacacat
acaagttactccgccctaaaacctacgtcacccgccccgttcccacgccccgcgccacgt
cacaaactccaccccctcattatcatattggcttcaatccaaaataaggtatattattga
tgatnnnttaattaaggatccnnncggtgtgaaataccgcacagatgcgtaaggagaaaa
taccgcatcaggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg
ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg
gataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag
gccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga
cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccct
ggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc
tttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg
gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgc
tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca
ctggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagag
ttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgct
ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc
accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaagga
tctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactca
cgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaat
taaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac
caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagtt
gcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagt
gctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccag
ccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtct
attaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgtt
gttgnnnnnnaaaaaggatcttcacctagatccttttcacgtagaaagccagtccgcaga
aacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaa
gcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcgg
ttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttggga
agccctgcaaagtaaactggatggctttctcgccgccaaggatctgatggcgcaggggat
caagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgc
acgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacaga
caatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttcttt
ttgtcaagaccgacctgtccggtgccctgaatgaactgcaagacgaggcagcgcggctat
cgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgg
gaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttg
ctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatc
cggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcgga
tggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccag
ccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcgtcgtgaccc
atggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcg
actgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgata
ttgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccg
ctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattttgt
taaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaacatccct
tataaatcaaaagaatagaccgcgatagggttgagtgttgttccagtttggaacaagagt
ccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgat
ggcccactacgtgaaccatcacccaaatcaagttttttgcggtcgaggtgccgtaaagct
ctaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaac
gtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgta
gcggtcacgctgcgcgtaaccaccacacccgcgcgcttaatgcgccgnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Storage -20°C


Cat. No.
Product Name
Price
A00185-200
cGFP-tag Antibody, mAb, Mouse - 200 ug
$349.00
A00185-40
cGFP-tag Antibody, mAb, Mouse - 40 ug
$99.00
A00185-100
cGFP-tag Antibody, mAb, Mouse - 100 ug
$199.00
 
Xie WB, .et alSmad2 and Myocardin-Related Transcription Factor B Cooperatively Regulate Vascular Smooth Muscle Differentiation From Neural Crest Cells. Circ Res.2013 Sep 27;113(8):e76-86.

Warnock A, .et alAmlodipine prevents apoptotic cell death by correction of elevated intracellular calcium in a primary neuronal model of Batten disease (CLN3 disease).Biochem Biophys Res Commun.2013 Jul 12;436(4):645-9.

You can visit "Citations Database" for more citations.





For more documents, please visit "Technical Support".