You are here: Products » PCR and Cloning » siRNA Expression Vector
GenScript Share
siRNA vector

siRNA Expression Vectors

GenScript provides a complete set of vectors for the expression of siRNA. These vectors use U6 (regular or enhanced), H1 (regular, inducible or enhanced) or CMV promoter to drive the siRNA expression. Each vector carries a neomycin, hygromycin, zeomycin or puromycin resistance gene as the selectable marker, which can be used for establishing stable cell lines. Some of the vectors carry a coral GFP (cGFP) marker for tracking transfection efficiency. To complete its siRNA set, Gencript also provides viral-based (Lenti, Retro, Adeno) siRNA vectors for more effective delivery of siRNA into almost any mammalian cell, including non-dividing cells and whole model organisms

GenScript also provides a pool of vector primers for your convenience. With GenScript's innovative technology and committed support, you have a partnership for success. Read on and click the following links for more information on our vector protocols, restriction enzyme maps, vector maps, sequences, and price details.

  • Expression Vectors
  • siRNA Controls
  • Vector Primers

Plasmid siRNA Expression Vectors

These vectors are designed for mammalian transfection. They each carry a neomycin, hygromycin, or zeomycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. The pRNAT vectors also carry a GFP marker (coral GFP or cGFP) under CMV promoter* control, which can be used to track transfection efficiency. They use regular or enhanced U6, or H1, or CMV promoters to drive siRNA expression.
Quantity. Cat. No Vector Promoter Resistance Marker Map Size Price
SD1201 pRNA-U6.1/Neo U6 Neomycin - Map 10 μg $225.00
SD1202 pRNA-U6.1/Hygro U6 Hygromycin - Map 10 μg $225.00
SD1207 pRNA-U6.1/Zeo U6 Zeomycin - Map 10 μg $225.00
SD1203 pRNA-H1.1/Neo H1 Neomycin - Map 10 μg $225.00
SD1204 pRNA-H1.1/Hygro H1 Hygromycin - Map 10 μg $225.00
SD1208 pRNA-H1.1/Zeo H1 Zeomycin - Map 10 μg $225.00
SD1231 pRNA-CMV3.1/Neo CMV Neomycin - Map 10 μg $225.00
SD1232 pRNA-CMV3.1/Hygro CMV Hygromycin - Map 10 μg $225.00
SD1233 pRNA-CMV3.1/Puro CMV Puromycin - Map 10 μg $225.00
SD1211 pRNAT-U6.1/Neo U6 Neomycin cGFP Map 10 μg $350.00
SD1212 pRNAT-U6.1/Hygro U6 Hygromycin cGFP Map 10 μg $350.00
SD1213 pRNAT-H1.1/Neo H1 Neomycin cGFP Map 10 μg $350.00
SD1214 pRNAT-H1.1/Hygro H1 Hygromycin cGFP Map 10 μg $350.00
SD1261 pRNAT-CMV3.1/Neo CMV Neomycin cGFP Map 10 μg $350.00
SD1262 pRNAT-CMV3.1/Hygro CMV Hygromycin cGFP Map 10 μg $350.00
SD1263 pRNAT-CMV3.1/Puro CMV Puromycin cGFP Map 10 μg $350.00
SD1264 pRNAT-CMV3.2/Neo CMV Neomycin cGFP Map 10 μg $350.00
SD1265 pRNAT-CMV3.2/Hygro CMV Hygromycin cGFP Map 10 μg $350.00
SD1266 pRNAT-CMV3.2/Puro CMV Puromycin cGFP Map 10 μg $350.00
SD1552 pRNA-H1.3/Neo H1 (enhanced) Neomycin - Map 10 μg $250
SD1561 pRNAT-U6.3/Hygro U6 (enhanced) Hygromycin cGFP Map 10 μg $350.00
SD1563 pRNAT-H1.3/Hygro H1 (enhanced) Hygromycin cGFP Map 10 μg $350.00

Inducible siRNA Expression Vectors

The H1.2 promoter is an engineered inducible promoter** containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR, causing the TetR protein to release the TetO1 site, and depress transcription.
Quantity. Cat. No Vector Promoter Resistance Marker Map Size Price
SD1205 pRNATin-H1.2/Neo H1 Neomycin cGFP Map 10 μg $350.00
SD1206 pRNATin-H1.2/Hygro H1 Hygromycin cGFP Map 10 μg $350.00
SD1216 pRNAin-H1.2/Neo H1 Neomycin - Map 10 μg $350.00
SD1234 pRNA-H1.2/Shuttle H1 Kanamycin cGFP Map 10 μg $350.00
SD1209 pRNAin-H1.2/Shuttle H1 Neomycin - Map 10 μg $350.00
SD1219 pRNATin-H1.4/Retro H1 (inducible) Hygromycin cGFP Map 10 μg $350.00

Viral siRNA Vectors

The H1.2 promoter is an engineered inducible promoter** containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR, causing the TetR protein to release the TetO1 site, and depress transcription.
Quantity. Cat. No Vector Promoter Resistance Marker Map Size Price
SD1205 pRNA-U6.1/Shuttle U6 Neomycin - Map 10 μg $225.00
SD1206 pRNA-H1.1/Shuttle H1 Neomycin - Map 10 μg $225.00
SD1216 pRNAT-H1.1/Shuttle H1 Neomycin cGFP Map 10 μg $350.00
SD1234 pRNA-H1.2/Shuttle H1 (inducible) Neomycin - Map 10 μg $350.00
SD1209 pRNA-H1.1/Adeno H1 Kanamycin - Map 10 μg $225.00
SD1219 pRNAT-H1.1/Adeno H1 Kanamycin cGFP Map 10 μg $350.00
SD1229 pRNATin-H1.2/Adeno H1 (inducible) Kanamycin cGFP Map 10 μg $350.00
SD1241 pRNA-H1.1/Retro H1 Hygromycin - Map 10 μg $225.00
SD1253 pRNAT-H1.4/Retro H1 Hygromycin cGFP Map 10 μg $350.00
SD1254 pRNATin-H1.4/Retro H1 (inducible) Hygromycin cGFP Map 10 μg $350.00


* Limited Use Label License: The use of CMV promoter is covered under U. S. Patents Nos. 5,168,062 and 5,385,839, owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF at 319-335-4546.

** Limited Use Label License: This H1.2 inducible promoter is covered by United States Patent Applications Nos. 60,505,677, owned by GenScript USA Inc.. The purchase of this product conveys to the buyer the limited, non-exclusive, non-transferable right (without the right to resell, repackage, or further sublicense) under these patent rights to perform the siRNA synthesis methods claimed in the patent application for research and development purposes solely in conjunction with this product.

Positive Controls:


siRNA positive controls are useful as a means of checking experimental systems. That is, when the expected results appear with a positive control siRNA, one may be reasonably sure that the transfections, the RNA extraction, and the assay, are reliable and robust. A good positive control reagent targets a well-expressed but non-essential gene. Such controls are useful for establishing experimental parameters without affecting cellular viability. Some positive controls can also be used as negative controls.

Ordering Information

Quantity. Cat. No Name Description Size Price
SD1501 pRNA-U6.1/Neo/siFLuc si-FLuc insert in pRNA-U6.1/Neo 10 μg $225.00
SD1502 pRNA-U6.1/Hygro/siFLuc si-FLuc insert in pRNA-U6.1/Hygro 10 μg $225.00
SD1503 pRNA-H1.1/Neo/siFLuc si-FLuc insert in pRNA-H1.1/Neo 10 μg $225.00
SD1504 pRNA-H1.1/Hygro/siFLuc si-FLuc insert in pRNA-H1.1/Hygro 10 μg $225.00
SD1531 pRNA-CMV3.1/Neo/siFLuc si-FLuc insert in pRNA-CMV3.1/Neo 10 μg $225.00
SD1532 pRNA-CMV3.1/Hygro/siFLuc si-FLuc insert in pRNA-CMV3.1/Hygro 10 μg $225.00
SD1512 pRNAT-U6.1/Hygro/siFLuc si-FLuc insert in pRNAT-U6.1/Hygro
(with cGFP)
10 μg $225.00
SD1551 pRNA-U6.3/Neo/siFLuc si-FLuc insert in pRNA-U6.3/Neo 10 μg $225.00
SD1523 pRNATin-H1.2/Neo/siFLuc si-FLuc insert in pRNATin-H1.2/Neo 10 μg $225.00
SD1553 pRNA-H1.3/Neo/siFLuc si-FLuc insert in pRNA-H1.3/Neo 10 μg $225.00
SD1565 pRNAT-U6.3/Hygro/siFLuc si-FLuc insert in pRNAT-U6.3/Hygro
(with cGFP)
10 μg $350.00
SD1566 pRNAT-H1.3/Hygro/siFLuc si-FLuc insert in pRNAT-H1.3/Hygro
(with cGFP)
10 μg $350.00
SD1601 pRNA-U6.1/Neo/siRLuc si-RLuc insert in pRNA-U6.1/Neo 10 μg $225.00
SD1602 pRNA-U6.1/Hygro/siRLuc si-RLuc insert in pRNA-U6.1/Hygro 10 μg $225.00
SD1603 pRNA-H1.1/Neo/siRLuc si-RLuc insert in pRNA-H1.1/Neo 10 μg $225.00
SD1604 pRNA-H1.1/Hygro/siRLuc si-RLuc insert in pRNA-H1.1/Hygro 10 μg $225.00
SD1701 pRNA-U6.1/Neo/sicGFP si-cGFP insert in pRNA-U6.1/Neo 10 μg $225.00
SD1702 pRNA-H1.1/Neo/sicGFP si-cGFP insert in pRNA-H1.1/Neo 10 μg $225.00

Negative Controls:

A non-targeting siRNA control helps to determine whether or not any decrease in gene expression levels observed with a gene-specific siRNA is related to a sequence-specific RNAi event. Global down-regulation may be due to cellular stress responses to a certain transfection reagent or technique. Without negative controls, a researcher might mistakenly interpret this broad, non-specific silencing as true gene-specific silencing. Negative siRNA control reagents are designed to have no known target in the cell line of choice. These reagents allow researchers to distinguish sequence-specific silencing from sequence-independent effects. Such sequence-independent effects can include toxicity resulting from the process of transfection in conjunction with nucleic acid delivery or hypersensitivity to the introduction of double-stranded RNA. Investigators are encouraged to test multiple candidates in their own experimental systems to empirically confirm that the negative controls do not result in any observable and unintended off-target effects.

Ordering Information

Quantity. Cat. No Name Description Size Price
SD1801 pRNA-U6.1/Neo/CTL Negative Control in pRNA-U6.1/Neo 10 μg $225.00
SD1802 pRNA-H1.1/Neo/CTL Negative Control in pRNA-H1.1/Neo 10 μg $225.00
SD1831 pRNA-CMV3.1/Neo/CTL Negative Control in pRNA-CMV3.1/Neo 10 μg $225.00


GenScript vector primers are HPLC purified, and sequencing tested. Each vial contains a total of 500 pmol lyopholized oligonucleotide


Quantity Cat. No Product Name Datasheet Primer Sequence Size Price
DA0001 pUC57 Forward Datasheet GTAAAACGACGGCCAGTG 500 pmol $30.00
DA0002 pUC57 Reverse Datasheet GGAAACAGCTATGACCATG 500 pmol $30.00
DA0003 M13 Forward (-20) Datasheet GTAAAACGACGGCCAGTG 500 pmol $30.00
DA0004 M13 Forward (-41) Datasheet GGTTTTCCCAGTCACGAC 500 pmol $30.00
DA0005 M13 Reverse (-27) Datasheet GGAAACAGCTATGACCATG 500 pmol $30.00
DA0006 M13 Reverse (-48) Datasheet AGCGGATAACAATTTCACAC 500 pmol $30.00
DA0007 BGH Reverse Datasheet TAGAAGGCACAGTCGAGG 500 pmol $30.00
DA0008 SP6 Datasheet TACGATTTAGGTGACACTATAG 500 pmol $30.00
DA0009 T7 Datasheet TAATACGACTCACTATAGGG 500 pmol $30.00
DA0010 T7 Terminator Datasheet GCTAGTTATTGCTCAGCGG 500 pmol $30.00
DA0011 pRNA-U6 Forward Datasheet TACGATACAAGGCTGTTAGAGAG 500 pmol $30.00
DA0012 pRNA Reverse Datasheet TAGAAGGCACAGTCGAGG 500 pmol $30.00
DA0013 pRNA-H1 Forward Datasheet TAATACGACTCACTATAGGG 500 pmol $30.00
DA0014 pShuttle-H1.1 Reverse Datasheet CAAAACTACATAAGACCCCCAC 500 pmol $30.00
DA0015 pAdTrack-H1.1 Forward Datasheet ATGGGAACATACGTCATTATTGAC 500 pmol $30.00
DA0016 pAdTrack-H1.1 Reverse Datasheet TGCGCGTTGTCAAATATGAGCTCA 500 pmol $30.00
DA0018 T3 promoter Datasheet ATTAACCCTCACTAAAGGGA 500 pmol $30.00
DA0019 pET 5' (T7) Datasheet TAATACGACTCACTATAGG 500 pmol $30.00
DA0020 pET 3' Datasheet CTAGTTATTGCTCAGCGG 500 pmol $30.00
DA0021 pGEX 5' Datasheet GGGCTGGCAAGCCACGTTTGGTG 500 pmol $30.00
DA0022 pGEX 3' Datasheet CCGGGAGCTGCATGTGTCAGAGG 500 pmol $30.00
DA0023 pRNA-CMV Forward Datasheet GTACGGTGGGAGGTCTATAT 500 pmol $30.00
DA0024 pRNA-H1.3 Forward Datasheet GACGTCAATGGGAGTTTGTT 500 pmol $30.00
DA0025 SD1241 Forward Datasheet TGTAGGTTTGGCAAGCTAGC 500 pmol $30.00
DA0026 SD1255 Forward Datasheet CCAACTTGTTTATTGCAGCT 500 pmol $30.00
DA0027 SD1258 Forward Datasheet GGGAAATCACCATAAACGTG 500 pmol $30.00
DA0028 SD1258 Reverse Datasheet TGGGCTATGAACTAATGACCC 500 pmol $30.00
DA0029 SD0122 Reverse Datasheet CTAGTCAGACAAAATGATGC 500 pmol $30.00
DA0030 SD0123 Forward Datasheet ATTATTCATACCGTCCCACCA 500 pmol $30.00
DA0031 SD0123 Reverse Datasheet ACCTCTACAAATGTGGTATGG 500 pmol $30.00
DA0032 SD1563 Forward Datasheet CTGGGAAATCACCATAAACG 500 pmol $30.00