You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNAT-U6.1/Hygro
|
||||||||||
![]() pRNAT-U6.1/HygroDescriptionpRNAT-U6.1/Hygro is a GenScript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell line. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a U6 promoter for siRNA expression.![]() StorageStore at -20°CDownload Protocoltm0169Forward Sequencing PrimerDA0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 78 - 101U6 Promoter: 6300 - 77 CMV Promoter: 140 - 727 cGFP: 744 - 1463 SV40 Promoter: 2152 - 2497 Hygromycin: 2520 - 3545 pUC ori: 4215 - 4855 Ampicillin: 5003 - 5863 Vector Sequence and Restriction Enzyme Map Limited Use Label LicenseThe use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546. Document
Related Products
|
||||||||||












