You are here: Products » PCR and Cloning » siRNA Expression Vector » siRNA Vector : pRNA-CMV3.1/Neo/CTL
|
||||||||||
![]() pRNA-CMV3.1/Neo/CTLDescriptionpRNA-CMV3.1/Neo/CTL is a GenScript general-purpose siRNA negative control vector. It is designed for mammalian transfection. It uses a CMV promoter for siRNA expression. The sense sequence shows no homology to any mouse or rats mRNA sequence in the NCBI RefSeq database. This vector can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.StorageStore at -20°CDownload Protocoltm0172Forward Sequencing PrimerDA0023: pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT)Reverse Sequencing PrimerDA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)Detailed MapPolylinker: 584 - 651CMV Promoter: 1 - 583 SV40 Promoter: 1267 - 1612 Neomycin: 1653 - 2447 pUC ori: 3161 - 3801 Ampicillin: 3949 - 4809 Vector Sequence and Restriction Enzyme Map Document
|
||||||||||











