Catalog Products » SafeEdit TRAC sgRNA (HPLC)

SafeEdit TRAC sgRNA

SafeEdit TRAC sgRNA (HPLC)
KIOK1
$49.00

Ask us a question
Overview
Description HPLC purified SafeEdit sgRNA with modifications targeting the first exon of the constant chain of the TCRα gene (TRAC), which enhances CAR-T cell potency and persistence by utilizing the endogenous transcriptional control of TCR gene. 

For customized sgRNA synthesis service, please visit :https://www.genscript.com/crispr-cas9-single-guide-RNA-and-ribonucleoprotein.html

[Reference] Roth. et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 2018, 559(7714): 405-409.
Sequence
mA*mG*mA*GUCUCUCAGCUGGUACAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*mU*mU
m = 2'O-Methyl RNA;  * = Phosphorothioate
Storage Condition Stable for at least 12 months at -20°C. Avoid repeated freeze-thaw cycles.
Quality Specifications
Item Specifications
Molecular Weight ≤+/- 0.05% from theoretical molecular weight by mass spectrometry
Purity ≥90% by RNase-free HPLC