Catalog Products » Stable Cell Lines » Human Recombinant Gα15 Stable Cell Line

CHO-K1/Gα15 Stable Cell Line

Recombinant CHO-K1 cells stably overexpress G15 alpha subunit protein (Gα15), which belongs to Gq/11/14/15 alpha subunit family. When Gα15 and Gs-coupled or Gi/o-coupled receptor are co-expressed in cells, the cells not only can be triggered to stimulate or inhibit the cAMP pathway based on the coupled G alpha subunit types, but also can conduct Gq-coupled signal transduction and mobilize intracellular calcium following certain ligand binding. This cell line is recommended to use as a host cell line for transient or stable expression of Gs and Gi/o -coupled receptors, which is able to provide more readouts to study G protein-coupled receptors.
M00257
$8,500.00

Ask us a question
Overview
Product Description Recombinant CHO-K1 cells stably overexpress G15 alpha subunit protein (Gα15), which belongs to Gq/11/14/15 alpha subunit family. When Gα15 and Gs-coupled or Gi/o-coupled receptor are co-expressed in cells, the cells not only can be triggered to stimulate or inhibit the cAMP pathway based on the coupled G alpha subunit types, but also can conduct Gq-coupled signal transduction and mobilize intracellular calcium following certain ligand binding. This cell line is recommended to use as a host cell line for transient or stable expression of Gs and Gi/o -coupled receptors, which is able to provide more readouts to study G protein-coupled receptors. 

Product Introduction
Expressed Gene Codon Optimized from NM_002068; no expressed tags
Target Protein NP_002059
Host Cell CHO-K1
Quantity 2 vials of frozen cells (>1X106 per vial in 1 ml)
Storage Store cells in liquid nitrogen immediately upon receipt. Thaw and recover cells within one year from the date received.
Mycoplasma Status Negative. The mycoplasma test was performed with MycoAlert™ PLUS Mycoplasma Detection Kit (Cat. No. LT07-318, Lonza).
Stability Stable through more than 15 passages with no significant changes in assay performance or expression profile.

Culture Conditions
Culture Properties Adherent
Freeze Medium 45% complete growth medium, 45% FBS (Cat. No. 10099-141, Gibco), 10% DMSO (Cat. No. D2650, Sigma)
Complete Growth Medium Ham’s F-12K (Kaighn’s) Medium (Cat. No. 21127-022, Gibco), 10% FBS (Cat. No. 10099-141, Gibco)
Culture Medium Ham’s F-12K (Kaighn’s) Medium (Cat. No. 21127-022, Gibco), 10% FBS (Cat. No. 10099-141, Gibco), 100 μg/ml Hygromycin B (Cat. No. 10687010, Invitrogen)

Background
Gene Synonyms GNA15, GNA16
Background The sequence of Gα15
ATGGCCCGCTCGCTGACCTGGCGCTGCTGCCCCTGGTGCCTGACGGAGGATGAGAAGGCCGCCGCCCGGGTGGACCAGGAGATCAA
CAGGATCCTCTTGGAGCAGAAGAAGCAGGACCGCGGGGAGCTGAAGCTGCTGCTTTTGGGCCCAGGCGAGAGCGGGAAGAGCACC
TTCATCAAGCAGATGCGGATCATCCACGGCGCCGGCTACTCGGAGGAGGAGCGCAAGGGCTTCCGGCCCCTGGTCTACCAGAACATC
TTCGTGTCCATGCGGGCCATGATCGAGGCCATGGAGCGGCTGCAGATTCCATTCAGCAGGCCCGAGAGCAAGCACCACGCTAGCCTG
GTCATGAGCCAGGACCCCTATAAAGTGACCACGTTTGAGAAGCGCTACGCTGCGGCCATGCAGTGGCTGTGGAGGGATGCCGGCAT
CCGGGCCTACTATGAGCGTCGGCGGGAATTCCACCTGCTCGATTCAGCCGTGTACTACCTGTCCCACCTGGAGCGCATCACCGAGGAG
GGCTACGTCCCCACAGCTCAGGACGTGCTCCGCAGCCGCATGCCCACCACTGGCATCAACGAGTACTGCTTCTCCGTGCAGAAAACCA
ACCTGCGGATCGTGGACGTCGGGGGCCAGAAGTCAGAGCGTAAGAAATGGATCCATTGTTTCGAGAACGTGATCGCCCTCATCTACCT
GGCCTCACTGAGTGAATACGACCAGTGCCTGGAGGAGAACAACCAGGAGAACCGCATGAAGGAGAGCCTCGCATTGTTTGGGACTAT
CCTGGAACTACCCTGGTTCAAAAGCACATCCGTCATCCTCTTTCTCAACAAAACCGACATCCTGGAGGAGAAAATCCCCACCTCCCACC
TGGCTACCTATTTCCCCAGTTTCCAGGGCCCTAAGCAGGATGCTGAGGCAGCCAAGAGGTTCATCCTGGACATGTACACGAGGATGTAC
ACCGGGTGCGTGGACGGCCCCGAGGGCAGCAAGAAGGGCGCACGATCCCGACGCCTCTTCAGCCACTACACATGTGCCACAGACACA
CAGAACATCCGCAAGGTCTTCAAGGACGTGCGGGACTCGGTGCTCGCCCGCTACCTGGACGAGATCAACCTGCTGTGA

feedback

Do you like the current new website?

Hate

Dislike

Neutral

Like

Love

*