IVD Raw Materials
Resources » Reference Databases » Citations Database
| Products/Services Used | Details | Operation |
|---|---|---|
| CRISPR RNAs/Cas9 Proteins(INACTIVE)> | The cells were counted and suspended with the PD-1-KO-hROBO1-CAR ssDNA, the PD-1 sgRNA (sequence: CCAACACATCGGAGAGCTTCGTG), and the NLS-Cas9- EGFP nuclease GenCrispr (GenScript, USA) in the electroporation buffer at the cell number and plasmid concentration described in the results section. | Get A Quote |
Lung cancer is the most common cancer and one of the leading causes of cancer-related deaths in the world, however, the treatment of non-small cell lung cancer (NSCLC) is still limited, and it is a clinically urgent problem. ROBO1 is an important surface receptor on tumor cells, but the role of humanized chimeric antigen receptor (CAR) modified natural killer (NK) cells targeting ROBO1 in NSCLC is rarely explored. Furthermore, the role of PD-1 in NK cell killing tumor cells remains controversial. In this study, we identified the expression pattern of ROBO1 in lung squamous cell carcinoma (LUSC) by searching biological information databases. We constructed hROBO1-CAR-NK-92 cells and performed functional identifi... More