Resources » Reference Databases » Citations Database

For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Novel ANO1 Inhibitor from Mallotus apelta Extract Exerts Anticancer Activity through Downregulation of ANO1.

International Journal of Molecular Sciences. 2020-09; 
Seo Y,Anh NH,Heo Y,Park SH,Kiem PV,Lee Y,Yen DTH,Jo S,Jeon D,Tai BH,Nam NH,Minh CV,Kim SH,Nhiem NX,Namkung W
Products/Services Used Details Operation
Catalog Gene Editing PLentiCRISPRv2 vector containing Cas9 and CRISPR guide RNA targeting ANO1 (CCTGATGCCGAGTGCAAGTA) (Clone ID: X35909) was purchased from Genscript (Piscataway, NJ, USA). Get A Quote

Abstract

Keywords

Article Link >

Most Popular Services

Homology-Directed Repair (HDR) Knock-in Templates
CRISPR Cas9 Single guide RNA (sgRNA) and Ribonucleoprotein (RNP)
Plasmid DNA Preparation Service
Mammalian CHO Expression Service