Resources » Reference Databases » Citations Database

For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Methylenetetrahydrofolate reductase gene polymorphism， homocysteine and risk of macroangiopathy in Type 2 diabetes mellitus.

J. Endocrinol. Invest.. 2006; 
SunJ，XuY，ZhuY
Products/Services Used Details Operation
Gene Synthesis … Approximately 120 ng of genomic DNA was incubated in a total reaction mixture of 20 μL containing both the forward primer 5′ TGAAGGAGAAGGTGTCTGCGGGA 3′ and reverse primer 5′ AGGACGGTGCGGTGAGAGTG 3′ (~ 10picomoles) (GenScript Corp, USA), 200 μM … Get A Quote

Abstract

A polymorphism in the gene for methylenetetrahydrofolate reductase (MTHFR) has been reported to be associated with hyperhomocysteinemia and risk for atherosclerotic vascular diseases. In this case-control study， we examined the distribution of the MTHFR genotypes in the Chinese population and clarified the relationship between the gene polymorphism for MTHFR and macroangiopathy in Chinese Type 2 diabetes mellitus.

Keywords

Article Link >

Most Popular Services

Homology-Directed Repair (HDR) Knock-in Templates
CRISPR Cas9 Single guide RNA (sgRNA) and Ribonucleoprotein (RNP)
Plasmid DNA Preparation Service
Mammalian CHO Expression Service