For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Characterization of a Novel Adhesin-like Gene and Design of a Real-Time PCR for Rapid, Sensitive, and Specific Detection of Spiroplasma kunkelii.

Plant Dis.. 2006; 
WeiWei,OpgenorthDan C,DavisRobert E,ChangChung-Jan,SummersCharles G,Zha
Products/Services Used Details Operation
Gene Synthesis … custom synthesized by Invitrogen Corp. (Carlsbad, CA). The TaqMan probe, sk104-213 (5′ TGGGAC GATATAGTGATACCAGTTGCCC 3′), was custom synthesized by GenScript Corp. (Scotch Plains, NJ) and was labeled … Get A Quote

Abstract

Spiroplasma kunkelii, a cell wall-less bacterium, is the causal agent of corn stunt disease. The pathogen is restricted to phloem sieve cells of infected plants and is transmitted by phloem-feeding leafhoppers. Since symptoms of corn stunt disease may not appear until close to flowering time, early detection of the pathogen in disease-transmitting leafhoppers and in symptomless foliar tissues of host plants is critical to disease forecasting and outbreak management. In this study, a field-deployable real-time polymerase chain reaction (PCR) assay was developed for sensitive and specific detection of S. kunkelii. Nucleotide sequence from a previously unreported adhesin-like gene was used to design primer... More

Keywords

diagnostic techniques,mollicutes,sa