IVD Raw Materials
Resources » Reference Databases » Citations Database
| Products/Services Used | Details | Operation |
|---|---|---|
| Synthetic Guide RNA> | sgRNA targeting SPPL3 (5’-3’:AGACAGATGCTCCAATTGGA)GenScript | Get A Quote |
Despite the success of autologous chimeric antigen receptor (CAR)-T cell therapy, achieving persistence and avoiding rejection in allogeneic settings remains challenging. We showed that signal peptide peptidase-like 3 (SPPL3) deletion enabled glycan-mediated immune evasion in primary T cells. SPPL3 deletion modified glycan profiles on T cells, restricted ligand accessibility, and reduced allogeneic immunity without compromising the functionality of anti-CD19 CAR molecules. In a phase I clinical trial, SPPL3-null, T cell receptor (TCR)-deficient anti-CD19 allogeneic CAR-T cells reached the safety primary endpoint, with grade 3 or higher cytokine release syndrome (CRS) observed in 3 out of 9 patients with relapse... More