For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Glycan shielding enables TCR-sufficient allogeneic CAR-T therapy

Cell. 2025-08; 
Zeguang Wu, Jinhong Shi, Qiezhong Lamao, Yuanyuan Qiu, Jinxin Yang, Yang Liu, Feifei Liang, Xue Sun, Wei Tang, Changya Chen, Qingming Yang, Chunmeng Wang, Zhifang Li, Haixia Zhang, Zhonghan Yang, Yunyi Zhang, Yuting Yi, Xufen Zheng, Yu Sun, Kuiying Ma, Lingling Yu, Huihui Yang, Zhaoxuan Wang, Wenjuan Zheng, Ling Yang, Zhixuan Zhang, Yongjian Zhang, Zhiqiang Wu, Yao Wang, Catherine C L Wong, Ming Jin, Pengfei Yuan, Weidong Han, Wensheng Wei
Products/Services Used Details Operation
Synthetic Guide RNA sgRNA targeting SPPL3 (5’-3’:AGACAGATGCTCCAATTGGA)GenScript Get A Quote

Abstract

Despite the success of autologous chimeric antigen receptor (CAR)-T cell therapy, achieving persistence and avoiding rejection in allogeneic settings remains challenging. We showed that signal peptide peptidase-like 3 (SPPL3) deletion enabled glycan-mediated immune evasion in primary T cells. SPPL3 deletion modified glycan profiles on T cells, restricted ligand accessibility, and reduced allogeneic immunity without compromising the functionality of anti-CD19 CAR molecules. In a phase I clinical trial, SPPL3-null, T cell receptor (TCR)-deficient anti-CD19 allogeneic CAR-T cells reached the safety primary endpoint, with grade 3 or higher cytokine release syndrome (CRS) observed in 3 out of 9 patients with relapse... More

Keywords

CAR-T cell; activation-induced cell death; allogeneic immunity; genome-wide CRISPR screens; glycan; graft-versus-host disease; host-versus-graft; natural killer cell; relapsed/refractory B-NHL; signal peptide peptidase-like 3.