For each citation that was shared on social media (LinkedIn, Facebook, or Twitter) with the “@GenScript” tag, the author will be rewarded with a $10 Amazon gift card or 2,000 GS points.

Characterization and Engineering of Two Novel Strand-Displacing B Family DNA Polymerases from Bacillus Phage SRT01hs and BeachBum

Biomolecules. 2025-08; 
Yaping Sun, Kang Fu, Wu Lin, Jie Gao, Xianhui Zhao, Yun He, Hui Tian
Products/Services Used Details Operation
Protein Electrophoresis and Western The eStain L1 (L00657C, Genscript, Nanjing, China) was used to stain the protein gels. The single-stranded DNA template (200bp, AGGTCGCCAGTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAAAGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGGGGGATTCAATGAATATTTATACCGATTCCGCAGTATTGCACTCTATCGTCGCCAGCCC) and a primer (CTGGCGACCTGGGCTGGCGAC) were synthesized by Genscript Biotechnology (Nanjing, China). The coding sequences of Phi29 polymerase, wild-type SRHS and BBum polymerases, and other mutant variants were codon-optimized for E. coli expression, synthesized and cloned into the Pet30a plasmids by Genscript Biotechnology (Nanjing, China). Get A Quote
CRISPR KI Templates Get A Quote

Abstract

Polymerase-coupled nanopore sequencing requires DNA polymerases with strong strand displacement activity and high processivity to sustain continuous signal generation. In this study, we characterized two novel B family DNA polymerases, SRHS and BBum, isolated from Bacillus phages SRT01hs and BeachBum, respectively. Both enzymes exhibited robust strand displacement, 3'→5' exonuclease activity, and maintained processivity under diverse reaction conditions, including across a broad temperature range (10-45 °C) and in the presence of multiple divalent metal cofactors (Mg2+, Mn2+, Fe2+), comparable to the well-characterized Phi29 polymerase. Through biochemical analysis of mutants designed using AlphaFold3-predic... More

Keywords

Mg2+-dependence modified substrate incorporation; Phi29-like processivity; exonuclease activity.